Endoplasmic Reticulum Labeling Lentivirus (ETS)(RFP)
Specifications
SKU | LVP728 |
Name | Endoplasmic Reticulum Labeling Lentivirus (ETS)(RFP) |
Unit | 2 x 100µl |
Vector | pLenti-III-RFP-N |
Description |
This Endoplasmic Reticulum Labeling Lentivirus can be used to easily label the endoplasmic reticulum. The vector expresses RFP (Red Fluorescent Protein) sandwiched between the Endoplasmic Reticulum Targeting Signal (ETS), which localizes proteins to the endoplasmic reticulum. This lentivirus offers a simple method to visualize the endoplasmic reticulum without antibodies or chemical dyes. Combine with other organelle labeling lentiviruses for multiplexed labeling. |
Applications |
|
Storage Condition |
For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles. |
Shipping Conditions |
Shipped with dry ice. |
Documents
Supporting Protocol
FAQs
How long after transduction can the infection efficiency be observed? | |
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
What are the primers to use for SV40T and SV40T tsA58 detection? | |
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
What is the sequence of the SV40 large T antigen? | |
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
For G221 and LV620, what does the 'V12' in RasV12 mean? | |
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
Where is the SV40T tsA58 gene sequence? | |
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
References
There are no references for this product yet!
Controls and Related Product: