ERT2-CRE-ERT2 Lentiviral Vector (Bacteriophage P1) (Other)
Cat. No.
LV010145
Unit
Price
$240.00
Specifications
| SKU | LV010145 |
| Name | ERT2-CRE-ERT2 Lentiviral Vector (Bacteriophage P1) (Other) |
| Unit | |
| Vector | pLenti-III |
| Description |
ERT2-Cre-ERT2 fusion protein is a tamoxifen-regulated form of Cre recombinase (Cre) fused to a mutant estrogen ligand-binding domain (ERT2). Cre recombinase is a Type I topoisomerase from P1 bacteriophage that catalyzes site-specific recombination of DNA between loxP sites. The CMV promoter has been removed from pLenti-III and replaced with a GATA5 promoter. |
| Applications |
abm recommends using Cat# G074, Lentifectin™ in conjunction with one of the following packaging mixes. The suggested packaging mix for this vector is Cat# LV003, 2nd Generation Packaging Mix. Alternatively, you can also use Cat# LV053, 3rd Generation Packaging Mix |
| Format | Plasmid |
| Storage Condition |
10mM Tris-HCI, 1mM EDTA, pH8.0 |
| Guarantee |
abm guarantees that the correct ORF construct is provided and the mRNA expression is displayed upon successful transduction. If this is not the case, we will provide a one-time replacement. Customers must provide adequate data to show >80% transfection efficiency with a positive control, plus additional qPCR data to evaluate the level of gene expression. The replacement will not be covered by the same guarantee. |
FAQs
| Are your pPB protein expression vectors high or low copy number plasmids? | |
|
Our protein expression vectors are medium copy number plasmids and can be amplified using any standard miniprep or midi/maxi prep kits.
There is no standard protocol that fits all proteins, therefore recombinant protein expression will need to be optimized and determined experimentally.
|
| How long after transduction can the infection efficiency be observed? | |
|
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
| What are the primers to use for SV40T and SV40T tsA58 detection? | |
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
| What is the sequence of the SV40 large T antigen? | |
|
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
| When the protein is expressed from this vector, which enzyme do I need to use to remove my tag? | |
|
The enzyme required to remove the tag (if possible) will depend upon the vector backbone corresponding to your product:
1) pPB-C-His: the His tag is NOT cleavable.
2) pPB-His-GST: the His-GST tag can be cleaved using TEV protease.
3) pPB-His-MBP: the His-MBP tag can be cleaved using TEV protease.
4) pPB-N-His: the His tag can be cleaved with Thrombin.
5) pPM-C-HA: the HA tag is NOT cleavable.
6) pPM-C-His: the His tag is NOT cleavable.
7) pPM-N-D-C-HA: the N-terminal D-tag can be cleaved using TEV protease. The C-terminal HA tag is NOT cleavable.
8) pPM-N-D-C-His: the N-terminal D-tag can be cleaved using TEV protease. The C-terminal His tag is NOT cleavable.
Please see the following page for further details:
https://www.abmgood.com/Protein-Vector.html
|
| For G221 and LV620, what does the 'V12' in RasV12 mean? | |
|
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
| Where is the SV40T tsA58 gene sequence? | |
|
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
References
There are no references for this product yet!
Controls and Related Product: