Autophagosome Labeling Lentivirus (MAP1LC3B)(GFP)
Specifications
SKU | LVP730 |
Name | Autophagosome Labeling Lentivirus (MAP1LC3B)(GFP) |
Unit | 2 x 100µl |
Vector | pLenti-III-GFP-N |
Description |
This Autophagosome Labeling Lentivirus can be used to easily label the autophagosome. The vector expresses GFP (Green Fluorescent Protein) fused to the N-terminus of the Microtubule Associated Protein 1 Light Chain 3 Beta (MAP1LC3B), which is involved in formation of autophagosomal vacuoles. This lentivirus offers a simple method to visualize the autophagosome without antibodies or chemical dyes. Combine with other organelle labeling lentiviruses for multiplexed labeling. |
Applications |
|
Storage Condition |
For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles. |
Shipping Conditions |
Shipped with dry ice. |
Documents
Supporting Protocol
FAQs
How long after transduction can the infection efficiency be observed? | |
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
What are the primers to use for SV40T and SV40T tsA58 detection? | |
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
What is the sequence of the SV40 large T antigen? | |
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
For G221 and LV620, what does the 'V12' in RasV12 mean? | |
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
Where is the SV40T tsA58 gene sequence? | |
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
References
There are no references for this product yet!
Controls and Related Product: