dCas9-TET1CD Lentivirus
Cat. No.
K090
Unit
4 x 500ul
Price
$365.00
Specifications
| SKU | K090 |
| Name | dCas9-TET1CD Lentivirus |
| Unit | 4 x 500ul |
| Caution | This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information. |
| Vector | pLenti-EF1a-dCas9-tet1CD |
| Description |
This construct consists of the catalytic domain of Ten-Eleven Translocation dioxygenase 1 (TET1CD) fused to the C-terminus of Cas9 Double Mutant (dCas9). The Cas9 Double Mutant has changes at amino acid positions D10A and H840A which completely inactivate both nuclease and nickase activities; whereas the TET1 domain facilitates the process of demethylation leading to transcriptional up-regulation. By using specific sgRNAs, the dCas9-TET1CD can be targeted to a promoter region allowing for epigenetic control over the expression of almost any gene of interest. |
| Shipping Conditions |
Shipped with dry ice |
Documents
There are no Documents for this product yet!
FAQs
| How long after transduction can the infection efficiency be observed? | |
|
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
| What are the primers to use for SV40T and SV40T tsA58 detection? | |
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
| What is the sequence of the SV40 large T antigen? | |
|
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
| For G221 and LV620, what does the 'V12' in RasV12 mean? | |
|
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
| Where is the SV40T tsA58 gene sequence? | |
|
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
References
There are no references for this product yet!