dCas9 Synergistic Activation Mediator Lentivector
Cat. No.
K015
Unit
10 µg
Price
$205.00
Specifications
| SKU | K015 |
| Name | dCas9 Synergistic Activation Mediator Lentivector |
| Unit | 10 µg |
| Caution | This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information. |
| Vector | pLenti-EF1a-dCas9-SAM |
| Description |
This Cas9 Double Mutant (dCas9) has changes at amino acid positions D10A and H840A which completely inactivate both the nuclease and nickase activities. With a target-specific guide RNA (sgRNA), it can bind to a specific region of DNA without cutting it. In this construct, dCas9 carries a C-terminal tripartite synergistic activation mediator (SAM). By targeting dCas9-SAM to a promoter region, users will be able to specifically induce expression of virtually any gene of interest. |
| Shipping Conditions |
Shipped at ambient temperature |
Documents
There are no Documents for this product yet!
FAQs
| How long after transduction can the infection efficiency be observed? | |
|
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
| What are the primers to use for SV40T and SV40T tsA58 detection? | |
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
| What is the sequence of the SV40 large T antigen? | |
|
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
| What system is your dCas9-SAM? | |
|
Our dCas9-SAM is the VPR version (i.e. dCas9-VPR).
|
| What are the suggested culture conditions? | |
|
Please consult the optimized culture condition for the particular cells you are working with as well as follow the standard protocol for lentiviral transduction.
|
| What is the frequency of off targets? | |
|
dCas9-SAM will exhibit off target effects only if it can bind to another gene promoter or the target gene ,200 nucleotide upstream of the transcriptional start site (TSS). Since dCas9 is a catalytically dead enzyme, it should not exhibit any nuclease activity. We recommend testing dCas9-SAM and non-targeting guide RNA’s along with your experimental testing to ensure specificity under your specific experimental conditions.
|
| Does abm's dCas9-SAM contain a N or C terminal NLS sequence? | |
|
Our dCas9-SAM utilizes VPR for gene activation. Yes, the dCas9-SAM contains a NLS sequence
at the C-terminus of the VPR region.
|
| Are dCas9-SAM mediated effects short term or long term? | |
|
It depends on the transient vs stable transfection of your sgRNA’s along with dCas9-SAM. Original testing of dCas9-SAM was done using transient transfection, lasting 36-48 hours. dCas9-SAM causes transient epigenetic changes, resulting in gene activation and does not cause permanent genomic editing. It provides robust and specific gene activation as long as both dCas9-SAM and target specific sgRNA’s are present in your experimental conditions. Theoretically speaking, once dCas9-SAM/sgRNA’s are removed, gene expression will revert to the basal level.
|
| How would you experimentally validate the dCas9-SAM activity in your system? | |
|
Quantitative PCR is a standard method that can be used for looking at changes in gene expression levels (i.e. activation/increase in expression with dCas9-SAM). Since dCas9-SAM causes robust gene activation, (provided adequate sgRNA design is used), there will be an increase in your gene of interest expression once subjected to dCas9-SAM. Changes in your gene expression will be affected by baseline level of gene expression of your target gene, i.e. genes with lower basal level expression may exhibit greater change in expression under dCas9-SAM testing conditions.
|
| Does abm offer sgRNA’s compatible with the dCas9-SAM system? | |
|
We are currently working on creating the CRISPR activation (CRISPRa) library! If you are interested in designing sgRNA’s for your specific target, abm offers custom design services where we can design 3 sets of tiled sgRNA’s for your genomic target.
|
| Would the CRISPR KO sgRNA’s libraries work with the dCas9-SAM? | |
|
No, CRISPR KO sgRNA’s are specifically designed for knocking out a gene. Since dCas9-SAM sgRNA’s target the promoter region and induce gene expression, these sgRNA’s are designed differently.
|
| When is it appropriate to use dCas9-SAM lentivector vs dCas9-SAM lentivirus? | |
|
dCas9-SAM lentivector is more relevant for transient transfections (e.g. 36-48 hours). Since dCas9-SAM lentivirus integrates into the host genome, dCas9-SAM is stably expressed in the cell line of interest and can be used for monitoring long term effects/changes in gene expression and provides stronger and more robust gene activation.
|
| Can we use only one sgRNA per target for dCas9-SAM testing or is it appropriate to pool multiple sgRNA’s? | |
|
Based on our experience with dCas9-SAM testing, pooled sgRNA’s (3-6) give stronger response (synergistic activation) as opposed to using individual sgRNA’s. This system results in multiplexed activation through the simple introduction of a collection of guide RNAs against a desired set of gene(s).
|
| For G221 and LV620, what does the 'V12' in RasV12 mean? | |
|
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
| Where is the SV40T tsA58 gene sequence? | |
|
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
References
- Chavez, A et al. "Highly-efficient Cas9-mediated transcriptional programming" Nat. Methods 12(4):326-328 (2015). DOI: 10.1038/nmeth.3312.
- Dai, X., Chen, X., Hakizimana, O., & Mei, Y. "Genetic interactions between ANLN and KDR are prognostic for breast cancer survival" Oncology Reports. : (2019).