Cas9 Nuclease Lentivirus
Cat. No.
K003
Unit
4 x 500ul
Price
$365.00
Specifications
| SKU | K003 |
| Name | Cas9 Nuclease Lentivirus |
| Unit | 4 x 500ul |
| Caution | This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information. |
| Vector | pLenti-EF1a-Cas9-Puro |
| Description |
This Cas9 nuclease can be used with a target-specific sgRNA to bind DNA and create a double-stranded cut. |
| Format | Virus |
| Storage Condition | stable for 1 year (when stored at -80°C or below) |
| Shipping Conditions |
Shipped with dry ice |
Documents
FAQs
| How long after transduction can the infection efficiency be observed? | |
|
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
| What are the primers to use for SV40T and SV40T tsA58 detection? | |
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
| What is the sequence of the SV40 large T antigen? | |
|
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
| For G221 and LV620, what does the 'V12' in RasV12 mean? | |
|
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
| Where is the SV40T tsA58 gene sequence? | |
|
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
References
- The Board of Regents of the University of Texas System., . "GENERATION OF GENETICALLY ENGINEERED ANIMALS BY CRISPR/CAS9 GENOME EDITING IN SPERMATOGONIAL STEM CELLS" United States Patent Application 20190134227. Retrieved from : (2019).
- Mohler, . "U" S. Patent Application No. 0201442 A1 : (2019).