Spag9 siRNA Oligos set (Rat)

Cat. No.

PS645191

Unit

4 x 5 nmol

Price

$705.00

Specifications Print Custom Datasheet

Documents

Supporting Protocol

Other

FAQs

What is the difference between Retro-, Lenti-, and Adeno- viruses?

Retrovirus: Classic, can integrate into the genome but with low transduction efficiency. They are useful for gene transfer and protein expression in cells that have low transfection efficiency with other transfection reagents. Lentivirus: Can integrate into the genome with relatively high transduction efficiency and they are very useful for cells that have low transfection efficiency with other transfection reagents. No special competent cells required, as they are stable plasmids. Lentiviruses are a powerful tool for stable gene transfer to both dividing and non-dividing cells in vitro and in vivo. Adenovirus: Only work transiently (about 7 days) but have almost 100% transduction efficiency. Adenoviruses can infect a broad range of cell types with the highest efficiency and infection is not dependent on active host cell division. A second key feature is that high virus titers and high-level gene expression can be obtained in most mammalian cells.

What are the correct concentration units for each recombinant viral particle?

For lentiviruses and retroviruses, they are measured in CFU/ml (colony-forming units per millilitre). Transduction with lentiviruses and retroviruses can cause the formation of colonies, which can be quantified for concentration. For AAV the titer is measured as genome copies per mL (GC/mL). Adenoviruses are measured as PFU/ml (plaque-forming units per millilitre). Transduction with adenoviruses will kill packaging cells, forming plaques in the process for quantification. The concentration for all three types of viruses can also be classified as IU/ml (Infectious Units/ml). Ultimately, the units refers to the viral particles and different units reflect the different assays involved.

	What do I use to check if my cells were successfully immortalized by the SV40 agent?
	We have an SV40 T antibody that can be used for the western blot analysis. The catalog number is G202. Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below: http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html

	What are the primers to use for SV40 identification?
	SV40 Forward Primer Sequence 5’ ACTGAGGGGCCTGAAATGA SV40 Reverse Primer Sequence 5’ GACTCAGGGCATGAAACAGG These are qPCR primers and the band size is 61 bp.

	I want to linearize the siRNA vector for electroporation purposes. Can you suggest a cut site outside the expression cassette that I can use?
	HpaI or PacI will work to linearize the vector. Both sites are located outside of the LTRs.

	Do you have the scramble shRNA lentivirus vector for mouse and rat as control?
	Our scramble negative control can be used for human, mouse and rat. Please refer to Cat.# LV015-G for ordering information.

	Can this vector be used with the 3rd generation packaging system
	Yes, our siRNA lentivectors are 3rd generation, but can be packaged using either 2nd or 3rd generation packaging systems.

	Could I transiently transfect these vectors to my target cell using lipofectamine or fugene directly? If I can do in this way, how many siRNA do I need to order for one target gene. I notice for each gene you have four options, and also have ***_set. Is one siRNA lentivector enough for knock-down assay?
	You can use Lipofectamine to transiently transfect the vectors to your target cells. Since the effect of an siRNA on a gene in a particular cell line can vary, we suggest choosing the set of 4 siRNA constructs to increase your chances of getting good knockdown of your target gene in your cells.

Is the siRNA set composed of lentiviral vectors with shRNAs or siRNAs? Do you validate the RNA interference?

Our RNA interference lentiviral vectors contain siRNAs. We employ a dual convergent promoter system where the sense and antisense strands of the siRNA are expressed by two different promoters rather than in a hairpin loop - to avoid any possible recombination events that can occur. In cases where there are no verified and published siRNA sequences for your gene of interest, we use our siRNA design software to locate suitable target sites. If these designed siRNAs don't give efficient knock down of gene expression in your experiments, we offer a onetime replacement (free of charge) that will contain a new set of sequences to try. ABM guarantees that at least one out of the four siRNA Lentivector constructs purchased in a set will give over 70% knockdown efficiency within appropriate target cells showing >80% transfection efficiency. If these four constructs are still considered to be ineffective, then it is most likely the gene is not susceptible to siRNA knockdown.

	Can I use phoenix 293 cells to produce the lentivirus with the lentiviral siRNA plasmids you sell?
	The Phoenix 293T cells are suitable for retrovirus packaging but not for lentivirus packaging. To package our lentivectors, you will need to use a 2nd or 3rd generation packaging mix, like the ones we have here: http://www.abmgood.com/Lentivirus-Packaging-Systems.html

	I want to transfect the siRNA using Lipofectamine. How much of the siRNA do you recommend to transfect in a 60mm dish for efficient knock down of the gene?
	Since every gene is different, it is best to optimize the transfection condition to allow for the most siRNA vector used without having toxicity. Try transfecting a series of 5ug, 8ug, 10ug and 12ug of the siRNA with your cells and the best one will be the highest siRNA used without seeing toxicity.

	Are they high copy or low copy plasmids? What is expected plasmid DNA yield?
	These are high copy plasmids and should be propagated with an authentic DH5a strain. We typically see a yield of 300-500ug DNA from a 250mL culture.

What advantages / disadvantages exist between the Lenti-SV40, -SV40T, and SV40T+t vectors?

There are simply differences in the content of all vectors due to customer demand for variety. Lenti-SV40 will contain the whole SV40 gene, -SV40T, the large T Antigen only, and -SV40T&t the large and small T antigens only. It is up to the end user to decide which vectors will best suit their project, however we have successfully used Lenti-SV40 (whole gene) in a wide range of immortalization projects.

	What primers can I use to sequence my vectors?
	One forward sequencing reaction using the U6 primer should be sufficient: U6 forward sequencing primer 5'-TACGTCCAAGGTCGGGCAGGAAGA-3'

What enzymes can I use to cut the plasmids for verification?

BamHI will cut out GFP in these vectors, so you should see a 0.8kb band when you cut the plasmids with this enzyme (applies only to vectors containing GFP). Another method you can use to check for the insert is to perform an EcoRI digest. The parental vector contains 2 EcoRI sites, one between the two BbsI sites which were used to clone in the insert, and one located immediately after GFP. If the insert is cloned in, the first EcoRI site will be removed, and when this is cut by EcoRI, you will only get a linearized vector band. Ones that are still the parental plasmid with no insert cloned in will still contain both EcoRI sites, and cutting with EcoRI will give 2 bands, ~8.2kb + 0.8kb. Alternatively KpnI should give a 0.9kb band if the insert is present, and a linear vector band only if there is no insert present. The siRNA insert is cloned in with a KpnI site for screening purposes.

	How many ug DNA do you recommend to transfect cells in a 6 well plate?
	We recommend transfecting 2ug DNA (0.5ug/ul) per well of a 6-well plate.

	I want to know the shRNA lentivector set contains a mix of 4 plasmids or 4 individual plasmid？
	The vector sets are supplied as 4 individual constructs, only the pooled lentivirus is supplied as a mixed solution. Please also note that our system utilizes the expression of mature siRNA sequences from two convergent promoters and this is not a hairpin loop, shRNA based system.

	What is the accession number for the SV40?
	The SV40 covers the entire genome and the accession number is J02400.1. You can use this information to design primers for conventional PCR as well.

Can you please advice on a protocol for vector extraction from filter paper?

1) Cut out the circle on the filter paper (this is where the DNA will be spotted), and then cut it into tiny pieces into a 1.5ml tube. 2) Put 30-50ul of PCR-grade water, 10mM Tris, or TE buffer to elute the DNA from the filter paper. The liquid may be completely soaked up by the filter, this is OK. Cap the tube and leave at room temperature for 5 minutes. 3) Centrifuge the tube at high speed for 1 minute to collect the liquid, or use a pipette and "compress" the filter paper at the bottom of the tube to squeeze out as much liquid as possible. Collect the liquid in a new tube, and then use DH5a competent cells to amplify the plasmid, use the suitable antibiotic to select for positive clones.

	How long after transduction can the infection efficiency be observed?
	You can observe transduction efficiency from 48 hours up to 5 days after infection.

	What are the primers to use for SV40T and SV40T tsA58 detection?
	PCR primers: SV40T Forward Primer Sequence 5’ AGCCTGTAGAACCAAACATT 3' SV40T Reverse Primer Sequence 5’ CTGCTGACTCTCAACATTCT 3' The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.

	What is the sequence of the SV40 large T antigen?
	This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.

	For lentiviral siRNA construct sets, would you recommend using 4 siRNA constructs in the same packaging mixture and collecting the supernatant of the packaging cells, or should we introduce the constructs separately into packaging cells and pool the supernatants before infection. Which way is better to increase knock-down efficiency?
	We would recommend packaging separately first, so that you can see which construct works better prior to pooling them together to infect your target cells.

	Is the 5'LTR wildtype? For the 3' LTR, is the U3 region deleted?
	This is not the wildtype 5'LTR. The U3 region is removed.

How does lentiviral delivery of siRNA differ from shRNA?

siRNA and shRNA have the same intention and they are to silent gene expression by cleaving the target mRNA. However, their differences are as follows: a) siRNA (small interfering RNA) is a linear sequence that binds to the target mRNA and cleaves it, preventing the unwanted protein from being made b) shRNA (short hairpin RNA) is a DNA construct encoding a sequence of single stranded RNA and its complement, separated by a stuffer fragment, allowing the RNA molecule to fold back on itself, creating a hairpin loop Traditionally, siRNA is made synthetically and introduced into the cells as is which is short lived; whereas shRNA is cloned into a vector and then introduced cell's genome, which can prolong expression. However, shRNA poses a difficulty on amplification and sequencing and thus it is not easy to construct. abm has come up with a novel technology where we combined the ability to clone siRNA into a vector, but with the same effect as shRNA. With the help of a dual convergent promoter vector system, the sense and antisense strands of the siRNA are expressed by two different promoters rather than in a hairpin loop, which thus avoids any possible recombination events that can occur. However, the siRNA sequence is expressed in both directions, and therefore mimicks the actions of shRNA.

	For G221 and LV620, what does the 'V12' in RasV12 mean?
	The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).

	Where is the SV40T tsA58 gene sequence?
	The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.

References

Liang, Y., Song, X., Li, Y., Su, P., Han, D., Ma, T., … Yang, Q. "circKDM4C suppresses tumor progression and attenuates doxorubicin resistance by regulating miR-548p/PBLD axis in breast cancer" Oncogene 38(42):6850–6866 (2019). DOI: 10.1038/s41388-019-0926-z.
Verma, M., Asakura, Y., & Asakura, A. "Inhibition of microRNA‐92a increases blood vessels and satellite cells in skeletal muscle but does not improve duchenne muscular dystrophy–related phenotype in mdx mice" Muscle & Nerve 59(5):594–602 (2019). DOI: 10.1002/mus.26433.
Wu., Chien-Wei., . "Downregulation of MiR-144 by Triptolide Enhanced p85α−PTEN Complex Formation Causing S Phase Arrest of Human Nasopharyngeal Carcinoma Cells" European Journal of Pharmacology 855:137-148 (2019). DOI: 10.1016/j.ejphar.2019.04.052..
Wu, M.-J., Chen, Y.-S., Kim, M. R., Chang, C.-C., Gampala, S., Zhang, Y., … Chang, C.-J. "Epithelial-Mesenchymal Transition Directs Stem Cell Polarity via Regulation of Mitofusin" Cell Metabolism 29(4):993–1002.e6 (2019). DOI: 10.1016/j.cmet.2018.11.004.
Xiang, X., Zhou, Y., Sun, H., Tan, S., Lu, Z., Huang, L., & Wang, W. "Ivabradine abrogates TNF-α-induced degradation of articular cartilage matrix" International Immunopharmacology 66:347–353 (2019). DOI: 10.1016/j.intimp.2018.11.035.
Zhou, Y., Lei, J., Xie, Q., Wu, L., Jin, S., Guo, B., ... & Zhang, J. "Fibrinogen-like protein 2 controls sepsis catabasis by interacting with resolvin Dp5" Science Advances 5(11):eaax0629 (2019).
Zhu, R., Xue, X., Shen, M., Tsai, Y., Keng, P. C., Chen, Y., … Chen, Y. "NFκB and TNFα as individual key molecules associated with the cisplatin-resistance and radioresistance of lung cancer" Experimental Cell Research 374(1):181–188 (2019). DOI: 10.1016/j.yexcr.2018.11.022.

Other SPAG9 Products

SPAG9 Human

SPAG9 Mouse

SPAG9 Rat

SPAG9 Lentiviral Vector

SPAG9 AAV Vector

SPAG9 Adenovirus Vector

SPAG9 Protein Vector

SPAG9 ORF Vector

SPAG9 siRNA Vector

SPAG9 miRNA Vector

SPAG9 3'UTR Vector

SPAG9 CRISPR Knockout Vector

SPAG9 CRISPR Activation Vector

SPAG9 Control Vectors & Viruses Vector

SPAG9 circRNA Vector

SPAG9 Internal Vector