Enzyme pack: PI-Sce I and I-Ceu I; including buffer
Cat. No.
A005
Unit
50 µl I-PI-SceI; 50 µl l I-CeuI
Price
$175.00
Specifications
| SKU | A005 |
| Name | Enzyme pack: PI-Sce I and I-Ceu I; including buffer |
| Unit | 50 µl I-PI-SceI; 50 µl l I-CeuI |
| Caution | Not for diagnostic use. |
| Note |
NOT FOR RESALE without prior written consent of ABM. This product is distributed for laboratory research only. * pricing for blank cloning vectors for commercial customers is 1.5x the listed price |
FAQs
| Can this kit purify all adenoviruses into the titer level at least 10^11 pfu/mL? | |
|
Yes, if the insert gene in adenovirus is not toxic to cells. there are no difference in performance as regards to different kit and the difference is in the different amount of elution (final amount). However, high titer can be further concentrated with our buffer exchange kit.
|
| Would you have the titer data regarding adenoviruses that are lac g or cre recombinase gene-injected? | |
|
We have in house experience with these two genes and they are not toxic, so higher titer adenovirus can be prepared.
|
| I have a question regarding preparation adenovirus stock for in vivo use. Adenoviral storage buffer in Viral stock buffer exchange kit (Cat.No.G130) is composed of 2.5% glycerol etc. which make it hard to inject in vivo in general. Accoriding to FAQs, 10mM Tris(pH8.0)plus 4% sucrose seems to be better formulation, but how can I remove 2.5% glyserol etc. from adenoviral storage buffer? How can buffer be exchanged from adenoviral storage buffer(Cat.No.G130) to 10mM Tris, 4% sucrose? | |
|
In that case, you will have to go through the buffer exchange kit again using the sucrose buffer. A 3x20ml exchange will do the job.
|
| What are viral particle (VP), plaque formation unit (PFU), and infectious unit (IFU)? | |
|
Viral particles (VPs) represent the total number of viral particles (infectious and infection-deficient combined). Due to variations in virus preparations, the ratio of infectious /non-infectious varies significantly and therefore, VP does not reflect the concentration of virus in a preparation. PFU (plaque forming unit) represents the number of infectious or live viruses. It reflects the concentration of infectious viruses in a preparation. IFU (infectious unit) is biologically equivalent to PFU. For most virus preps, the VP/PFU ratio is 20:1 to 50:1.
|
| How are virus titers determined? | |
|
There are 3 commonly used protocols for determining adenovirus titer: (1) OD260 Assay, (2) Plaque Formation Assay, and (3) End-point Dilution Assay.
|
| How does TCID50 work? | |
|
Please see the link before for the assay. TCID50 is the same as end dilution assay.
http://www.abmgood.com/TechSupport/adeno-vec.php
If the customer provide us the virus, we can provide its titer with the Cat#C008 service.
|
| Is this adenoviral gene transfer technique available for in vivo use? Is it OK to inject via tail vein? | |
|
Yes, but higher titers up 1x10e12 pfu/ml have to be used. We do offer custom adenovirus amplification and purification.
|
| I'm wanting to overexpress my interest protein in mouse liver. Does this adenovirus transfer the gene specifically to the liver? | |
|
Over 95% of adenoviral vectors will end up in liver if you inject in the blood stream.
|
| What is the difference between Retro-, Lenti-, and Adeno- viruses? | |
|
Retrovirus: Classic, can integrate into the genome but with low transduction efficiency. They are useful for gene transfer and protein expression in cells that have low transfection efficiency with other transfection reagents. Lentivirus: Can integrate into the genome with relatively high transduction efficiency and they are very useful for cells that have low transfection efficiency with other transfection reagents. No special competent cells required, as they are stable plasmids. Lentiviruses are a powerful tool for stable gene transfer to both dividing and non-dividing cells in vitro and in vivo. Adenovirus: Only work transiently (about 7 days) but have almost 100% transduction efficiency. Adenoviruses can infect a broad range of cell types with the highest efficiency and infection is not dependent on active host cell division. A second key feature is that high virus titers and high-level gene expression can be obtained in most mammalian cells.
|
| What are the correct concentration units for each recombinant viral particle? | |
|
For lentiviruses and retroviruses, they are measured in CFU/ml (colony-forming units per millilitre). Transduction with lentiviruses and retroviruses can cause the formation of colonies, which can be quantified for concentration. For AAV the titer is measured as genome copies per mL (GC/mL). Adenoviruses are measured as PFU/ml (plaque-forming units per millilitre). Transduction with adenoviruses will kill packaging cells, forming plaques in the process for quantification. The concentration for all three types of viruses can also be classified as IU/ml (Infectious Units/ml). Ultimately, the units refers to the viral particles and different units reflect the different assays involved.
|
| What do I use to check if my cells were successfully immortalized by the SV40 agent? | |
|
We have an SV40 T antibody that can be used for the western blot analysis. The catalog number is G202.
Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below:
http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html
|
| What are the primers to use for SV40 identification? | |
|
SV40 Forward Primer Sequence
5’ ACTGAGGGGCCTGAAATGA
SV40 Reverse Primer Sequence
5’ GACTCAGGGCATGAAACAGG
These are qPCR primers and the band size is 61 bp.
|
| What advantages / disadvantages exist between the Lenti-SV40, -SV40T, and SV40T+t vectors? | |
|
There are simply differences in the content of all vectors due to customer demand for variety. Lenti-SV40 will contain the whole SV40 gene, -SV40T, the large T Antigen only, and -SV40T&t the large and small T antigens only.
It is up to the end user to decide which vectors will best suit their project, however we have successfully used Lenti-SV40 (whole gene) in a wide range of immortalization projects.
|
| I'd like to perform a buffer exchange, but your Buffer Exchange column Cat# G130 seems to be discontinued. Can you offer me any recommendations for doing this? | |
|
Unfortunately yes, our Buffer Exchange column G130 has now been discontinued due to a lack of supply for the filter component. In order to run your own buffer exchange you will require: 50K molecular weight cut off low protein binding membrane column (ensuring it will hold up to 15 ml) with a suggested buffer recipe as follows: 1 X PBS buffer, pH 7.2
|
| What is the accession number for the SV40? | |
|
The SV40 covers the entire genome and the accession number is J02400.1. You can use this information to design primers for conventional PCR as well.
|
| How long after transduction can the infection efficiency be observed? | |
|
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
| What are the primers to use for SV40T and SV40T tsA58 detection? | |
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
| What is the sequence of the SV40 large T antigen? | |
|
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
| For G221 and LV620, what does the 'V12' in RasV12 mean? | |
|
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
| Where is the SV40T tsA58 gene sequence? | |
|
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
References
- Siu, CW et al. "Modeling of lamin A/C mutation premature cardiac aging using patient-specific induced pluripotent stem cells" Aging (Albany NY) 4(11):803-822 (2012).
- Mcallister, J. M., Strauss, J. F., & Christensen, N. D. "U" S. Patent Application No. 16/201 360: (2019).
- Qimuge, N., He, Z., Qin, J., Sun, Y., Wang, X., Yu, T., … Pang, W. "Overexpression of DNMT3A promotes proliferation and inhibits differentiation of porcine intramuscular preadipocytes by methylating p21 and PPARg promoters" Gene 696:54–62 (2019). DOI: 10.1016/j.gene.2019.02.029.
Controls and Related Product: